@article{29c2c5f44e934060988813d582f59987,
title = "Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)",
abstract = "The original version of this Article contained an error for the {\textquoteleft}RPP30-Shear Forward Primer sequence{\textquoteright} provided in the {\textquoteleft}Intact Proviral DNA Assay (IPDA){\textquoteright} section of the Methods, which incorrectly read {\textquoteleft}CCAATTTGCTGCTCCTTGGG{\textquoteright}. The correct sequence of the {\textquoteleft}RPP30-Shear Forward Primer{\textquoteright} is {\textquoteleft}CCATTTGCTGCTCCTTGGG{\textquoteright}. This has been corrected in both the PDF and HTML versions of the Article.",
author = "Kinloch, {Natalie N.} and Yanqin Ren and Alberto, {Winiffer D.Conce} and Winnie Dong and Pragya Khadka and Huang, {Szu Han} and Mota, {Talia M.} and Andrew Wilson and Aniqa Shahid and Don Kirkby and Marianne Harris and Colin Kovacs and Erika Benko and Ostrowski, {Mario A.} and {Del Rio Estrada}, {Perla M.} and Avery Wimpelberg and Christopher Cannon and Hardy, {W. David} and Lynsay MacLaren and Harris Goldstein and Brumme, {Chanson J.} and Lee, {Guinevere Q.} and Lynch, {Rebecca M.} and Brumme, {Zabrina L.} and Jones, {R. Brad}",
note = "Publisher Copyright: {\textcopyright} The Author(s) 2021",
year = "2021",
month = dec,
day = "1",
doi = "10.1038/s41467-021-23515-z",
language = "English (US)",
volume = "12",
journal = "Nature Communications",
issn = "2041-1723",
publisher = "Nature Publishing Group",
number = "1",
}