Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)

Natalie N. Kinloch; Yanqin Ren; Winiffer D.Conce Alberto; Winnie Dong; Pragya Khadka; Szu Han Huang; Talia M. Mota; Andrew Wilson; Aniqa Shahid; Don Kirkby; Marianne Harris; Colin Kovacs; Erika Benko; Mario A. Ostrowski; Perla M. Del Rio Estrada; Avery Wimpelberg; Christopher Cannon; W. David Hardy; Lynsay MacLaren; Harris Goldstein; Chanson J. Brumme; Guinevere Q. Lee; Rebecca M. Lynch; Zabrina L. Brumme; R. Brad Jones

doi:10.1038/s41467-021-23515-z

Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)

Natalie N. Kinloch, Yanqin Ren, Winiffer D.Conce Alberto, Winnie Dong, Pragya Khadka, Szu Han Huang, Talia M. Mota, Andrew Wilson, Aniqa Shahid, Don Kirkby, Marianne Harris, Colin Kovacs, Erika Benko, Mario A. Ostrowski, Perla M. Del Rio Estrada, Avery Wimpelberg, Christopher Cannon, W. David Hardy, Lynsay MacLaren, Harris GoldsteinChanson J. Brumme, Guinevere Q. Lee, Rebecca M. Lynch, Zabrina L. Brumme, R. Brad Jones

Pediatrics

Research output: Contribution to journal › Comment/debate › peer-review

2 Scopus citations

Abstract

The original version of this Article contained an error for the ‘RPP30-Shear Forward Primer sequence’ provided in the ‘Intact Proviral DNA Assay (IPDA)’ section of the Methods, which incorrectly read ‘CCAATTTGCTGCTCCTTGGG’. The correct sequence of the ‘RPP30-Shear Forward Primer’ is ‘CCATTTGCTGCTCCTTGGG’. This has been corrected in both the PDF and HTML versions of the Article.

Original language	English (US)
Article number	2958
Journal	Nature communications
Volume	12
Issue number	1
DOIs	https://doi.org/10.1038/s41467-021-23515-z
State	Published - Dec 1 2021

ASJC Scopus subject areas

General Chemistry
General Biochemistry, Genetics and Molecular Biology
General Physics and Astronomy

UN SDGs

This output contributes to the following UN Sustainable Development Goals (SDGs)

Access to Document

10.1038/s41467-021-23515-z

Cite this

Kinloch, N. N., Ren, Y., Alberto, W. D. C., Dong, W., Khadka, P., Huang, S. H., Mota, T. M., Wilson, A., Shahid, A., Kirkby, D., Harris, M., Kovacs, C., Benko, E., Ostrowski, M. A., Del Rio Estrada, P. M., Wimpelberg, A., Cannon, C., Hardy, W. D., MacLaren, L., ... Jones, R. B. (2021). Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3). Nature communications, 12(1), Article 2958. https://doi.org/10.1038/s41467-021-23515-z

Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3). / Kinloch, Natalie N.; Ren, Yanqin; Alberto, Winiffer D.Conce et al.
In: Nature communications, Vol. 12, No. 1, 2958, 01.12.2021.

Research output: Contribution to journal › Comment/debate › peer-review

Kinloch, NN, Ren, Y, Alberto, WDC, Dong, W, Khadka, P, Huang, SH, Mota, TM, Wilson, A, Shahid, A, Kirkby, D, Harris, M, Kovacs, C, Benko, E, Ostrowski, MA, Del Rio Estrada, PM, Wimpelberg, A, Cannon, C, Hardy, WD, MacLaren, L, Goldstein, H, Brumme, CJ, Lee, GQ, Lynch, RM, Brumme, ZL & Jones, RB 2021, 'Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)', Nature communications, vol. 12, no. 1, 2958. https://doi.org/10.1038/s41467-021-23515-z

@article{29c2c5f44e934060988813d582f59987,

title = "Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)",

abstract = "The original version of this Article contained an error for the {\textquoteleft}RPP30-Shear Forward Primer sequence{\textquoteright} provided in the {\textquoteleft}Intact Proviral DNA Assay (IPDA){\textquoteright} section of the Methods, which incorrectly read {\textquoteleft}CCAATTTGCTGCTCCTTGGG{\textquoteright}. The correct sequence of the {\textquoteleft}RPP30-Shear Forward Primer{\textquoteright} is {\textquoteleft}CCATTTGCTGCTCCTTGGG{\textquoteright}. This has been corrected in both the PDF and HTML versions of the Article.",

author = "Kinloch, {Natalie N.} and Yanqin Ren and Alberto, {Winiffer D.Conce} and Winnie Dong and Pragya Khadka and Huang, {Szu Han} and Mota, {Talia M.} and Andrew Wilson and Aniqa Shahid and Don Kirkby and Marianne Harris and Colin Kovacs and Erika Benko and Ostrowski, {Mario A.} and {Del Rio Estrada}, {Perla M.} and Avery Wimpelberg and Christopher Cannon and Hardy, {W. David} and Lynsay MacLaren and Harris Goldstein and Brumme, {Chanson J.} and Lee, {Guinevere Q.} and Lynch, {Rebecca M.} and Brumme, {Zabrina L.} and Jones, {R. Brad}",

note = "Publisher Copyright: {\textcopyright} The Author(s) 2021",

year = "2021",

month = dec,

day = "1",

doi = "10.1038/s41467-021-23515-z",

language = "English (US)",

volume = "12",

journal = "Nature communications",

issn = "2041-1723",

publisher = "Nature Publishing Group",

number = "1",

}

TY - JOUR

T1 - Author Correction

T2 - HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)

AU - Kinloch, Natalie N.

AU - Ren, Yanqin

AU - Alberto, Winiffer D.Conce

AU - Dong, Winnie

AU - Khadka, Pragya

AU - Huang, Szu Han

AU - Mota, Talia M.

AU - Wilson, Andrew

AU - Shahid, Aniqa

AU - Kirkby, Don

AU - Harris, Marianne

AU - Kovacs, Colin

AU - Benko, Erika

AU - Ostrowski, Mario A.

AU - Del Rio Estrada, Perla M.

AU - Wimpelberg, Avery

AU - Cannon, Christopher

AU - Hardy, W. David

AU - MacLaren, Lynsay

AU - Goldstein, Harris

AU - Brumme, Chanson J.

AU - Lee, Guinevere Q.

AU - Lynch, Rebecca M.

AU - Brumme, Zabrina L.

AU - Jones, R. Brad

PY - 2021/12/1

Y1 - 2021/12/1

N2 - The original version of this Article contained an error for the ‘RPP30-Shear Forward Primer sequence’ provided in the ‘Intact Proviral DNA Assay (IPDA)’ section of the Methods, which incorrectly read ‘CCAATTTGCTGCTCCTTGGG’. The correct sequence of the ‘RPP30-Shear Forward Primer’ is ‘CCATTTGCTGCTCCTTGGG’. This has been corrected in both the PDF and HTML versions of the Article.

AB - The original version of this Article contained an error for the ‘RPP30-Shear Forward Primer sequence’ provided in the ‘Intact Proviral DNA Assay (IPDA)’ section of the Methods, which incorrectly read ‘CCAATTTGCTGCTCCTTGGG’. The correct sequence of the ‘RPP30-Shear Forward Primer’ is ‘CCATTTGCTGCTCCTTGGG’. This has been corrected in both the PDF and HTML versions of the Article.

UR - http://www.scopus.com/inward/record.url?scp=85105809810&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=85105809810&partnerID=8YFLogxK

U2 - 10.1038/s41467-021-23515-z

DO - 10.1038/s41467-021-23515-z

M3 - Comment/debate

C2 - 33986282

AN - SCOPUS:85105809810

SN - 2041-1723

VL - 12

JO - Nature communications

JF - Nature communications

IS - 1

M1 - 2958

ER -

Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)

Abstract

ASJC Scopus subject areas

UN SDGs

Access to Document

Other files and links

Fingerprint

Cite this